View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_low_16 (Length: 322)
Name: NF17041_low_16
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 18530651 - 18530341
Alignment:
| Q |
1 |
agaatatggtaaaagattgtgcttaattatgcaaactcaccaactgtgtactcaaaaaccaccaccacagtcatcactgcccacattgctgaaagaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18530651 |
agaatatggtaaaagattgtgcttaattatgcaaactcaccaactgtgtactcaaaaaccaccaccacagtcatcactgcccacattgctgaaagaccaa |
18530552 |
T |
 |
| Q |
101 |
aattttcataaagtggttgatagtagtaaaatagagacaccaaagagattgcaagtccaacttttagtgaatgaatcacttttcttgggtcatcttgtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18530551 |
aattttcataaagtggttgatagtagtaaaatagagacaccaaagagattgcaagtccaacttttagtgaatgaatcacttttcttgggtcatcttgtgc |
18530452 |
T |
 |
| Q |
201 |
tatttcttttgataacctacaaatgcatagcaccttcttcataagaacctttggaaaatctcttatttgctcccatactctaactagtacacatgctttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18530451 |
tatttcttttgataacctacaaatgcatagcaccttcttcataagaacctttggaaaatctcttatttgctcccatactctaactagtacacatgctttc |
18530352 |
T |
 |
| Q |
301 |
tcttgattcat |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
18530351 |
tcttgattcat |
18530341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University