View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17041_low_23 (Length: 249)

Name: NF17041_low_23
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17041_low_23
NF17041_low_23
[»] chr5 (1 HSPs)
chr5 (17-177)||(12033669-12033830)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 177
Target Start/End: Original strand, 12033669 - 12033830
Alignment:
17 aattagaacataagaaaaacgaagcaattatcaaattaaccttggatttaattttcccttctttccccttttgttgtgttcacataaaa--aatcaaaga 114  Q
    ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||| ||||  |||||||||    
12033669 aattagaacataagaaaaacggagcaattatcaaattaaccctggatttaattttcccttccttccc-ttttgttgtgttcacaaaaaaaaaatcaaaga 12033767  T
115 gatgagaactttagagatggtgattggtggctaggcaacgatgcgcagcaatggaggtgggag 177  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||    
12033768 gatgagaactttagagatggtgattggtggctaggaaacgatgcgcatcaatggaggtgggag 12033830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University