View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17042_low_2 (Length: 389)
Name: NF17042_low_2
Description: NF17042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17042_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 57 - 289
Target Start/End: Complemental strand, 868514 - 868283
Alignment:
| Q |
57 |
taactaaacgaaaatccactaacaccgttggcaaaattatggcattgtggatttcaaagtcctacaattttgaaattttaagcctcgttgagcccagtga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868514 |
taactaaacgaaaatccactaacaccgttggcaaaattatggcattgtggatttcaaagtcctacaattttgaaattttaagcctcgttgagcccagtga |
868415 |
T |
 |
| Q |
157 |
cacaaaatatcaattgtgggagtcgtttgttgcaactccatttgtgtgcgacatgctattgttccatattctagttgttgatcaaggtcgtatatgcaac |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868414 |
cacaaaatatcaattgtgggagtcg-ttgttgcaactccatttgtgtgcgacatgctattgttccatattctagttgttgatcaaggtcgtatatgcaac |
868316 |
T |
 |
| Q |
257 |
gagctagcttcccccgaatatattgatgcatgc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
868315 |
gagctagcttcccccgaatatattgatgcatgc |
868283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 349 - 387
Target Start/End: Complemental strand, 868248 - 868210
Alignment:
| Q |
349 |
ttggtggatcagatgaaacatgtatgtgatgatgtccat |
387 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
868248 |
ttggtggatcagatgaaacatgtaggtgatggtgtccat |
868210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University