View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17042_low_7 (Length: 235)
Name: NF17042_low_7
Description: NF17042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17042_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 34150394 - 34150599
Alignment:
| Q |
15 |
gatgaagcaaaagtgatatatcgtgactttaaaacttcaaatatattgctcgacacagtaagtatactctcactgctcttacaactcaattgtcaactgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34150394 |
gatgaagcaaaagtgatatatcgtgactttaaaacttcaaatatattgctcgacacagtaagtatactctcactgctcttacaactcaattgtcaactgg |
34150493 |
T |
|
| Q |
115 |
gcttttctgacactctgttttgtcaatgacagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgt |
214 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34150494 |
gcttttctgacattccgttttgtcaatgacagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgt |
34150593 |
T |
|
| Q |
215 |
ctctac |
220 |
Q |
| |
|
|||||| |
|
|
| T |
34150594 |
ctctac |
34150599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 30422277 - 30422354
Alignment:
| Q |
143 |
acagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgtctctac |
220 |
Q |
| |
|
|||||| ||||||||||| || || |||||||| |||| || |||||||| | ||||| ||| |||||||||||||| |
|
|
| T |
30422277 |
acagaactataatgcaaagctctcagattttgggatggcaaaagatggaccagaaggtggtaagagtcatgtctctac |
30422354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University