View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17042_low_8 (Length: 235)
Name: NF17042_low_8
Description: NF17042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17042_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 33498355 - 33498564
Alignment:
| Q |
9 |
gtcgaagaatatagtacaacatcaatgagagaagtgttatacagtgcaatatcgatgagaaaagcatgaccctatgtgtagtagattatatttcataatc |
108 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33498355 |
gtcgaaaagtatagtacaacatcaatgagagaagtgttatacagtgcaatatcgatgagaaaagcatgacccaatgtgtagtagattatatttcataatc |
33498454 |
T |
 |
| Q |
109 |
atttgcatttgataatccatatgggttgtatcacacaagtagagtcatcattgctaggttaattgtgcgttatttatggtgtggagtgtttactcttgat |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33498455 |
atttgcatttcataatccatatgggttgtatcacacaagtagagtcttcattgctaggttaattgtgcgttatttatggtgtggagtgtttactcttgat |
33498554 |
T |
 |
| Q |
209 |
gtcatataac |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
33498555 |
gtcatataac |
33498564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University