View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17043_high_25 (Length: 338)
Name: NF17043_high_25
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17043_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 11 - 322
Target Start/End: Original strand, 2262788 - 2263099
Alignment:
| Q |
11 |
aaaatcttggtcactttcaactttttcacctaaacccttattcttgtgatgctccactaaccaatcatctaaaactatatccaattctttggcagtttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262788 |
aaaatcttggtcactttcaactttttcacctaaacccttattcttgtgatgctccactaaccaatcatctaaaactatatccaattctttggcagtttct |
2262887 |
T |
 |
| Q |
111 |
ttcattgctttgactcctaatttcatccatcttagaattggaacagcatcagccattgtacatacccctaacatatgcatgaactctcttaatgccttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262888 |
ttcattgctttgactcctaatttcatccatcttagaattggaacagcatcagccattgtacatacccctaacatatgcatgaactctcttaatgccttta |
2262987 |
T |
 |
| Q |
211 |
caatattttgtgcttctttctcctttactacggctgtttcaccaaaatatctcttcccagccattgtttggaaaactacatattgaagaatttattagag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2262988 |
caatattttgtgcttctttctcctttactacggctgtttcaccaaaatatctcttcccagccattgtttggaaaactacatattgaagaatttattagag |
2263087 |
T |
 |
| Q |
311 |
ataggcaatgat |
322 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2263088 |
ataggcaatgat |
2263099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University