View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17043_high_30 (Length: 250)
Name: NF17043_high_30
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17043_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 28845366 - 28845589
Alignment:
| Q |
11 |
cataggacagaccaattgttgtattgactcttcgttgcaacttgatgacatctctaggttagtagatgatgaatattccccacaagcataaatttttgcc |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
28845366 |
cataggacgtaccaattgttgtattgactcttcgttgcaacttgatggcatctctaagttaatagatgataaatattccccacaagcaaaaatatttgcc |
28845465 |
T |
|
| Q |
111 |
nnnnnnnaagcacccaacaaattatcattgcattgtattgtccactttggctcatctttcagcaatctccacacatgctcaagtctgaaatcagcatcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| |
|
|
| T |
28845466 |
cttttttaagcacccaacaaattatcattgcattgtattgtccactttggctcatctttcagcaatctccagacatgctcaagtctgaaatcatcaccaa |
28845565 |
T |
|
| Q |
211 |
catcttgagaataaattgcgtttg |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
28845566 |
catcttgagaataaattgtgtttg |
28845589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University