View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17043_low_22 (Length: 364)
Name: NF17043_low_22
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17043_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 16824424 - 16824539
Alignment:
| Q |
1 |
ccacttcaatttagacaatattttatcacaattttctgcaatatttataatcactataactacaaatgttatcacaattacaaattaaaataaggtataa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16824424 |
ccacttctatttagacaatattttatcacaattttctgcaatatttagaatcactataactacaaatgttatcacaattacaaattaaaataaggtataa |
16824523 |
T |
|
| Q |
101 |
atagtcttattacaac |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16824524 |
atagtcttattacaac |
16824539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 240 - 346
Target Start/End: Original strand, 16824666 - 16824772
Alignment:
| Q |
240 |
gcttcttttttctgtttgttcactatataatattatcaattattttttactagtttgaagaactacaacaaggcttgggaattataagatctgaagatag |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16824666 |
gcttcttttttctgtttgttcactatataatattatcaattattttttactagtttgaagaactacaacaaggcttgggaattataagatctgaagatag |
16824765 |
T |
|
| Q |
340 |
ataagaa |
346 |
Q |
| |
|
||||||| |
|
|
| T |
16824766 |
ataagaa |
16824772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University