View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17043_low_34 (Length: 244)
Name: NF17043_low_34
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17043_low_34 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 154 - 244
Target Start/End: Complemental strand, 49290433 - 49290338
Alignment:
| Q |
154 |
attaattcaaaaaatgtagtaactcgtggaactatgtagtatt-----taatttattatcaatacttataaaaaagataacattacatttaaccct |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290433 |
attaattcaaaaaatgtagtaacttgtggaaccatgtagtattccctttaatttattatcaatacttataaaaaagataacattacatttaaccct |
49290338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 49297375 - 49297289
Alignment:
| Q |
163 |
aaaaatgtagtaactcgtggaactatgtagtatt-----taatttattatcaatacttataaaaaagataacattacatttaaccct |
244 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49297375 |
aaaaaggtagtaacttgtggaaccatgtagtattccctttaatttattatcaatacttataaaaaagataacattacatttaaccct |
49297289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 49290566 - 49290526
Alignment:
| Q |
19 |
aaggtggactaaatatttaggttaatttaattcgatataac |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290566 |
aaggtggactaaatatttaggttaatttaattcgatataac |
49290526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University