View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17043_low_36 (Length: 225)
Name: NF17043_low_36
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17043_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 25 - 206
Target Start/End: Original strand, 9455241 - 9455423
Alignment:
| Q |
25 |
aaattttgacccgtattatgcagcaaaatatcaaactaatcagcaaattaagtaactgaaagaatagatggcaaattaatt-aacaagatagagattata |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9455241 |
aaattttgacccgtattatgtagcaaaatatcaaactaatcagcaaattaagtaactgaaagaatagatggcaaattaatttaacaagatagagattata |
9455340 |
T |
 |
| Q |
124 |
ggtcacagagtagtgaaaaaattgtttctagtaatagctagttttatccaacacatatcaaagaaaatgataactattaaaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9455341 |
ggtcacagagtagtgaaaaaattgtttctagtaatagctagttttatccaacacatatcaaagaaaatgataactattaaaga |
9455423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University