View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17044_high_10 (Length: 269)
Name: NF17044_high_10
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17044_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 17564010 - 17563884
Alignment:
| Q |
22 |
taaactttaagaaagtggatcacttttgggagttatt------taaagtaactttttcaggacatttattgaaagcttaattcctattttttgaaagtaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17564010 |
taaactttaagaaagtggatcacttttgggagttattagctgatacacaaactttttcaagacatttattgaaagcttagttcctattttttgaaagtaa |
17563911 |
T |
 |
| Q |
116 |
gttcttcttccacggtttacttgtttt |
142 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
17563910 |
gttcctcttccacggtttacttgtttt |
17563884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 17562312 - 17562247
Alignment:
| Q |
163 |
ggatgagtgatcaccaacacaa-ggcatgattgcctctagcaatatggcttgctaccaaaatgtta |
227 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
17562312 |
ggatgagtgatcaccgatacaaaggcatgattgcctctagcaatatggattgttaccaaaatgtta |
17562247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 141
Target Start/End: Original strand, 29872028 - 29872085
Alignment:
| Q |
84 |
ttgaaagcttaattcctattttttgaaagtaagttcttcttccacggtttacttgttt |
141 |
Q |
| |
|
||||||| ||| || | ||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
29872028 |
ttgaaagtttagtttcaattttttgaaagtaagttcctctcccatggtttacttgttt |
29872085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University