View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17044_high_7 (Length: 309)
Name: NF17044_high_7
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17044_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 108 - 309
Target Start/End: Complemental strand, 46769603 - 46769401
Alignment:
| Q |
108 |
acggtagcttatttaaactatttatcttctacccatacagtcgcatcatagttcctccnnnnnnnnnnnnnnnnnnnnn-gattcatcattctataaaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46769603 |
acggtagcttatttaaactatttatcttctacccatacagtcgcatcatagttcctccaaaaagaaaaaagaaaaaaaaagattcatcattctataaaac |
46769504 |
T |
|
| Q |
207 |
ttgcataaatatctacattgaagatgctcaaaatgcttttgggtttcaacaacatatatttgatgaattgtgagattcactatcaaactattaatgaaaa |
306 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46769503 |
ttgcataaatatcttcattgaagatgctcaaaatgctcttgggtttcaacaacatatatttgatgaattgtgagattcactatcaaactattaatgaaaa |
46769404 |
T |
|
| Q |
307 |
tcc |
309 |
Q |
| |
|
||| |
|
|
| T |
46769403 |
tcc |
46769401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University