View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17044_low_10 (Length: 298)
Name: NF17044_low_10
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17044_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 150
Target Start/End: Original strand, 36865058 - 36865188
Alignment:
| Q |
20 |
aaccacttggagaagttcgttgtagatggcaacgtcagaataaattatctcaaagttgtgactaaacaagacctttagtttttccaaatgctcaactacc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36865058 |
aaccacttggagaagttcgttgtagatggcaacgtcagaataaattatctcaaagttgtgactaaacaagacctttagtttttccaaatgctctactacc |
36865157 |
T |
 |
| Q |
120 |
ttggaattacaagagtcttgactcttgagaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36865158 |
ttggaattacaagagtcttgactcttgagaa |
36865188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 149 - 288
Target Start/End: Original strand, 36865221 - 36865364
Alignment:
| Q |
149 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatg----catcaacattgagacgttcatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36865221 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatgtatatatcaacattgagacgttcatc |
36865320 |
T |
 |
| Q |
245 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865321 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
36865364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University