View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17044_low_12 (Length: 254)
Name: NF17044_low_12
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17044_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 46769382 - 46769154
Alignment:
| Q |
1 |
cttttatatattgcagtttagaccaggaatataacagccatgcctcttttgatttatctgttttatactcgacacattgtatagctgtgacataaagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46769382 |
cttttatatattgcagtttagaccaggaatataacagccatgcctcttttgatttatctgttttatactcgacacattgtatagctgtgacataaagtta |
46769283 |
T |
 |
| Q |
101 |
gacaatgtgtcaaagttgttgtttgatttaaattagataagaactaagccacatcagatgccacccatgcatgtgttagt----------aatttaatgg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
46769282 |
gacaatgtgtcaaagttgttgtttgatttaaattagataagaactaagccacatcagatgccacccatgcatgtgttagtagttgaatggaattgaatgg |
46769183 |
T |
 |
| Q |
191 |
acttgattgtaaattatagcataattata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46769182 |
acttgattgtaaattatagcataattata |
46769154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University