View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17044_low_7 (Length: 346)
Name: NF17044_low_7
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17044_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 8 - 333
Target Start/End: Original strand, 20284527 - 20284852
Alignment:
| Q |
8 |
ggtggttatgattctgatttcttggttagtgagtgtcaaaattatgaagagtcaaaattatatgatttctatgtctattttgaagatgtcaaaacaaagc |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20284527 |
ggtggttatgattctgatttcttggttggtgagtgtcaaaattatgaagagtcaaaattatatgatttctatgctttttttgaagatgtcaaaacaaagc |
20284626 |
T |
|
| Q |
108 |
tgaatgtcatatgtttggaagatgacgggtaatgtcacaagtaaaaattataagtctagtatttaaaaaatttctttcctcaatcaaacaaacaaacaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
20284627 |
tgaatgtcatatgtttggaagatgacgggtaatggcacaagtaaaaattataagtctagtatttaaaaaaattctttcctcaatcgaacaaacaaacaaa |
20284726 |
T |
|
| Q |
208 |
cactaatatcttctaaaattttctgataacaactttttaaacaaaattattattgactaaccatacgtattcattgaaaatttggttttttaaagtatct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
20284727 |
cactaatatcttctaaaattttctgataacaattttttaaacaaaattattattgactaaccatacgtattcattgaaaatttggttttgtatagtatct |
20284826 |
T |
|
| Q |
308 |
attctaccgtgtaagatgatcatttt |
333 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
20284827 |
atcctaccgtgtaagatgatcatttt |
20284852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University