View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17045_high_13 (Length: 236)
Name: NF17045_high_13
Description: NF17045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17045_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 39 - 210
Target Start/End: Original strand, 28745026 - 28745197
Alignment:
| Q |
39 |
taatgagtgagggtgactaggatgtttgatcagcaaggttagaacttagaagaaagagaagcttattttctttctatgatgtgaatcgaaaatgaagtgc |
138 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28745026 |
taatgagtgggggtgactaggatgtttgatcagcaaggttagaacttagaagaaagagaagcttattttctttctatgatgcgaatcgaaaatgaagtgc |
28745125 |
T |
 |
| Q |
139 |
gtttaggcaacaactcaagttgaactttgtcattttatatgtggatcttataattgtattgcttatttaaac |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28745126 |
gtttaggcaacaacacaagttgaactttgtcattttatacgtggatcttataattgtattgcttatttaaac |
28745197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 28744974 - 28745003
Alignment:
| Q |
18 |
ccactgtctgtacataataattaatgagtg |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28744974 |
ccactgtctgtacataataattaatgagtg |
28745003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University