View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17045_high_14 (Length: 208)
Name: NF17045_high_14
Description: NF17045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17045_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 39917227 - 39917286
Alignment:
| Q |
18 |
agtaagtttgttttttcgcctttaatttctttctgcatatgttgcttctcagtattaacg |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917227 |
agtaagtttgttttttcgcctttaatttctttctgcatatgttgcttctcagtattaacg |
39917286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 130 - 199
Target Start/End: Original strand, 39917339 - 39917406
Alignment:
| Q |
130 |
gagagtttgatgaagatagccatccttttggggactgtgcggcaccaatatcagctttcctatgctactc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
39917339 |
gagagtttgatgaagatagccatccttttggggactgt--ggcaccaatatcagctttcctattctactc |
39917406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 130 - 199
Target Start/End: Original strand, 39823365 - 39823432
Alignment:
| Q |
130 |
gagagtttgatgaagatagccatccttttggggactgtgcggcaccaatatcagctttcctatgctactc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
39823365 |
gagagtttgatgaagatagccatccttttggggactgt--ggcaccgatatcagctttcctattctactc |
39823432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 39908164 - 39908221
Alignment:
| Q |
18 |
agtaagtttgttttttcgcctttaatttctttctgcatatgttgcttctcagtattaa |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
39908164 |
agtaagtttgttttttcacctttaatttcttccagcatatgttgcttctcagtattaa |
39908221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 39823242 - 39823300
Alignment:
| Q |
18 |
agtaagtttgttttttcgcctttaatttctttctgcatatgttgcttctcagtattaacg |
77 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
39823242 |
agtaagtttgtttt-tcgcctttaatttctttctgcatatgttgcttcgcagtaataacg |
39823300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University