View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17045_low_13 (Length: 290)
Name: NF17045_low_13
Description: NF17045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17045_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 5 - 279
Target Start/End: Complemental strand, 4931917 - 4931643
Alignment:
| Q |
5 |
gatactgatagattgactcaagagatcggggcggtatttgtgattggaaattcatttgcctcgattacatgggaatcattttgatattttgaagagtaat |
104 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931917 |
gatactgatcgattgaatcaagaaatcggggcggtatttgtgagtggaaattcatttccctcgattacatgggaatcattttgatattttgaagagtaat |
4931818 |
T |
|
| Q |
105 |
tcttgcatgagatcgtagttttcgatcataactactcaaaaattcatgatatattaaaatgattaaaaggtgtccgtgtgcacaactgtggaggcttcgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931817 |
tcttgcatgagatcgtagttttcgatcataactactcaaaaattcatgatacattaaaatgattaaaaggtgtccgtgtgcacaactgtggaggcttcgg |
4931718 |
T |
|
| Q |
205 |
catgggcgtatggtgtaaatgattgataagtaaatgattgtaatgttgaaagggtgaaaggtgaaatatgtgatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931717 |
catgggcgtatggtgtaaatgattgataagtaaatgattgtaatgttgaaagggtgaaaggtgaaatatgtgatg |
4931643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University