View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17045_low_18 (Length: 206)
Name: NF17045_low_18
Description: NF17045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17045_low_18 |
 | |
|
| [»] scaffold0356 (1 HSPs) |
| | |
|
| [»] scaffold0075 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0356 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: scaffold0356
Description:
Target: scaffold0356; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 25 - 194
Target Start/End: Original strand, 11414 - 11583
Alignment:
| Q |
25 |
tgttcgcgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatg |
124 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
11414 |
tgttcgcatggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagttgaagaggttcttagtcgggcgctttccatggctgcgactgacg |
11513 |
T |
|
| Q |
125 |
gacacctcattccattgtcctattgctgtggagtctctttccccactcatattttatacgctgatgatgt |
194 |
Q |
| |
|
|||| ||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11514 |
gacaactcattccaatgtcctattgtcgtggagtatctttccccactcatattttatacgctgatgatgt |
11583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 43 - 194
Target Start/End: Original strand, 19739746 - 19739897
Alignment:
| Q |
43 |
caaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgt |
142 |
Q |
| |
|
|||||| |||||||||| || ||||| || ||||| ||||||||||||||||||||||| || ||||| ||| | ||| |||| |||| ||| ||| |
|
|
| T |
19739746 |
caaggacacccattgtcccctcttctcttctgtctggctgaagaggttcttagtcgggcactctccattgcttcaactttcggacgactcacaccaatgt |
19739845 |
T |
|
| Q |
143 |
cctattgctgtggagtctctttccccactcatattttatacgctgatgatgt |
194 |
Q |
| |
|
| ||||| |||| |||||| | |||||||| |||||||||||||| ||||| |
|
|
| T |
19739846 |
cttattgtcgtggggtctctcttcccactcagattttatacgctgacgatgt |
19739897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 48800 - 48730
Alignment:
| Q |
32 |
gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct |
102 |
Q |
| |
|
|||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || |||||| |
|
|
| T |
48800 |
gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct |
48730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 15144264 - 15144206
Alignment:
| Q |
31 |
cgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggt |
89 |
Q |
| |
|
||||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| |
|
|
| T |
15144264 |
cgtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggt |
15144206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 9077 - 9007
Alignment:
| Q |
32 |
gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct |
102 |
Q |
| |
|
|||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || |||||| |
|
|
| T |
9077 |
gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct |
9007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 96
Target Start/End: Complemental strand, 8636245 - 8636213
Alignment:
| Q |
64 |
cttcttttttgtctagctgaagaggttcttagt |
96 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
8636245 |
cttcttttttgtttagctgaagaggttcttagt |
8636213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University