View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17046_low_1 (Length: 363)
Name: NF17046_low_1
Description: NF17046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17046_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 131 - 345
Target Start/End: Original strand, 17258306 - 17258521
Alignment:
| Q |
131 |
atgtttttgagaagtacttaaa-ctttgtgaacttaataagtctaggtatgcaatgtactggaagatggattgtacactatcgacgaacctcatttggtt |
229 |
Q |
| |
|
|||| ||||||||||||||||| ||||| || |||||| ||| ||||||||||||| || |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17258306 |
atgtctttgagaagtacttaaagctttgcgagcttaatcagtttaggtatgcaatggaccggaagatggattctacactatcgacgaacctcatttggtt |
17258405 |
T |
|
| Q |
230 |
gccggttctcaaaatgtgctaagacaaagttagatgattcacttattatcaaaacttttcaaggacgtttctacagcatgtatttattaattttgcttca |
329 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17258406 |
accggttctcaaaatgtggtaagacaaagttagatgattcacttattatcaaaacttttcaaggacgtttctgcagcatgtatttattaattttgcttca |
17258505 |
T |
|
| Q |
330 |
ttattgtctgtaggat |
345 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
17258506 |
ttattgtatgtaggat |
17258521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 27 - 125
Target Start/End: Original strand, 6669041 - 6669139
Alignment:
| Q |
27 |
tttgttaatatttttattattattagagtaaacaaatagctgacaaaatatgttatgatttctttctgattcctttttgtaattccattatgatatgta |
125 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6669041 |
tttgttaatttttttattattattagagtaaacaaatagctgacaacatctgttatgatttctttctgattcctttttgtaattccataatgatatgta |
6669139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University