View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_high_12 (Length: 327)
Name: NF17047_high_12
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 301
Target Start/End: Complemental strand, 7182219 - 7181928
Alignment:
| Q |
8 |
agattattctgcagaaatttgtcaaatgtaaatcaagtccccccttgagattttgagtatttcaggaaaactaaaatattgttgtcccctcataattata |
107 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7182219 |
agattattctccagaaatgtgtcaaatgtaa-tcaagtcccac-ttgagattttgagtatttcaagaaaactaaaatattgttgtcccctcataattata |
7182122 |
T |
 |
| Q |
108 |
tcattagaattattttctagaaactgtggcgaagttttaacnnnnnnntttgggtgtcaaagtgagcataaagaatttacagttgcaaatttttaaaata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7182121 |
tcattagaattattttctagaaactgtggcgaagttttaacaaaaaaatttgggtgtcaaagtgagcataaagaatttacagttgcaaatttttaaaata |
7182022 |
T |
 |
| Q |
208 |
aaataaagtgcaaattcttgaaattgtaacaacagtagtagggcaacatgaacaaccaatcaaaataacgaaacacgtatcactacacaacaac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7182021 |
aaataaagtgcaaattcttgaaattgtaacaacagtagtagggcaacatgaacaaccaatcaaaataacgaaacacatatcactacacaacaac |
7181928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University