View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_high_16 (Length: 294)
Name: NF17047_high_16
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 45763120 - 45763398
Alignment:
| Q |
1 |
ataccatggtccagcaacgatccagaacccgaagaaccacctccaccagcgccaccacctatattctccggtaacaacttcaatgcgtcttcttcatgat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763120 |
ataccatggtccatcaacgatccagaaccagaagaaccacctccaccagcaccaccacctatattctccggtaacaacttcaatgcgtcttcttcatgat |
45763219 |
T |
 |
| Q |
101 |
gtttttgatcgccggtaacgctcatcagcttttggttttgccactgaaacgacgacgcatcattaaaaccgttaacgttaacattaccgttacggttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763220 |
gtttttgatcgccggtaacgctcatcagcttttggttttgccactgaaacgacgacgcatcattaaaaccgttaacgttaacattaccgttacggttatc |
45763319 |
T |
 |
| Q |
201 |
gttaccgataccaaatccaaacggcaatgtctcgttagaggaagtgatcaagcttgtgaaagttgcgatctctgagaat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763320 |
gttaccgataccaaatccaaacggcaatgtctcgttagaggaagtgatcaagcttgtgaaagttgcgatctctgagaat |
45763398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University