View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_high_29 (Length: 243)
Name: NF17047_high_29
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 9214121 - 9213913
Alignment:
| Q |
18 |
aatgtaaattattttctcatgtattcagggatgacaaagaacagcaattttgttaaagaggtctcctcacattttagaaaagaagatgaagttattgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9214121 |
aatgtaaattattttctcatgtattcagggatgacaaagaacagcaattttgttaaagaggtctcctcacattttagaaaagaagatgaagttattgttg |
9214022 |
T |
|
| Q |
118 |
taagtgcatgagattatgcatgttattttcaagtactccaacttaattcatctgccaatgtaaattaatgttgttgtttttgcagggttgtcagcttggg |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9214021 |
taagtgcatgagattatgtatgttattttcaagtactccaacttaattcatctgctaatgtaaattaatgttattgtttttgcagggttgtcagcttggg |
9213922 |
T |
|
| Q |
218 |
aaaaggtct |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
9213921 |
aaaaggtct |
9213913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University