View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_high_32 (Length: 209)
Name: NF17047_high_32
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 31610043 - 31610220
Alignment:
| Q |
14 |
cagagaaacaatgcatcgacgagatgctacaaaactactgcggcgagttcggacggtggcagctaaagcatttcgtactaacaagtctcgcatgggcatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610043 |
cagagaaacaatgcatcgacgagatgctacaaaactactgcggcgagttcggacggtggcagctaaagcatttcgtactaacaagtctcgcatgggcatt |
31610142 |
T |
 |
| Q |
114 |
ggaagcattccatacaatggttatgatatttgctgaccgtgaaccagaatggaggtgtctcgagggtgttgccggttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31610143 |
ggaagcattccatacaatggttatgatatttgctgaccgtgaaccagaatggaggtgtctcgacggtgttgccggttt |
31610220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 149
Target Start/End: Complemental strand, 34422599 - 34422475
Alignment:
| Q |
25 |
tgcatcgacgagatgctacaaaactactgcggcgagttcggacggtggcagctaaagcatttcgtactaacaagtctcgcatgggcattggaagcattcc |
124 |
Q |
| |
|
|||||||| |||||||| | || ||||| || ||||| ||| |||||||| || || ||| | || |||||||| || ||||| |||||||| || | |
|
|
| T |
34422599 |
tgcatcgatgagatgcttgagaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacaagtcttgcttgggcgttggaagcttttc |
34422500 |
T |
 |
| Q |
125 |
atacaatggttatgatatttgctga |
149 |
Q |
| |
|
|||| ||||||||||| |||||||| |
|
|
| T |
34422499 |
atactatggttatgatttttgctga |
34422475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University