View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_high_8 (Length: 368)
Name: NF17047_high_8
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 78 - 213
Target Start/End: Original strand, 52448789 - 52448925
Alignment:
| Q |
78 |
gtgtacatttttacatgtggtacaacatatgcaagaaatttatcataagattaacgtnnnnnnnnnn-ttatcataataaatattttctaattcaacaca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
52448789 |
gtgtacatttttacatgtggtacaacatatgcaagaaatttatcataagattaacgtaaaaaaaaaaattatcataataaatattttctaattcaataca |
52448888 |
T |
|
| Q |
177 |
aaaatatgataagcatataaattagttagggtaaagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52448889 |
aaaatatgataagcatataaattagttagggtaaagg |
52448925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 303 - 333
Target Start/End: Original strand, 52449017 - 52449047
Alignment:
| Q |
303 |
cgtcactacattatttcttcttctttactaa |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52449017 |
cgtcactacattatttcttcttctttactaa |
52449047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University