View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_low_1 (Length: 621)
Name: NF17047_low_1
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 358; Significance: 0; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 210 - 609
Target Start/End: Original strand, 27507110 - 27507511
Alignment:
| Q |
210 |
gaggatattaagctgttgtcgtggagatggagccttgctagattgaaaattccat-gtgtatgtattatgagtggagatggcatccgaaat-tctgcctt |
307 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27507110 |
gaggatattaagctgttgtcatggagatggagccttgctagattgaaaattccatcgtgtatgtattatgagtggagatggcatccgaaaaatctgcctt |
27507209 |
T |
 |
| Q |
308 |
gggaggaagtgattgtcaggttgcgtcgctggtgcaggggtgacggtggtgtttttcgactggtggaagggggatgctatttccctgttggcagtattct |
407 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27507210 |
gggaggaagtgattgtcaggttgcggcgctggtgtaggtgcgacggtggtgtttttcgactggtggaagggggatgctatttccctgttggcagtattct |
27507309 |
T |
 |
| Q |
408 |
cagtaggagcttttggtgacaacaatgcaggagatttagggttgagtcaaatgtaaaacaacttatttataggctagattttcttgagggattggctttg |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27507310 |
cagtaggagcttttggtgacaacaatgcaggagatttagggttgagtcaaatgtaaaacaacttatttataggctagattttcttgagggattggctttg |
27507409 |
T |
 |
| Q |
508 |
tgtccggtcactgcgatgagatctcgcggtctagatttaaagttggtaatgtttggatttttagaaaataaaaatatgacagttttaagaacgtttgata |
607 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27507410 |
tgtccggtcactacgatgagatctcgcggtctagatttaaagttggtaatgtttggatttttagaaaataaaaatatgacagttttaagaacgtttgata |
27507509 |
T |
 |
| Q |
608 |
tt |
609 |
Q |
| |
|
|| |
|
|
| T |
27507510 |
tt |
27507511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 27500731 - 27500812
Alignment:
| Q |
15 |
attttatgattctttcatttttctttttcatacttatacaggcatgaaggctttatatcatcattgctttacaattggtaac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27500731 |
attttatgattctttcatttttctttttcatacttatacatgcatgacagctttatatcaccatagctttacaattggtaac |
27500812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 27515523 - 27515604
Alignment:
| Q |
15 |
attttatgattctttcatttttctttttcatacttatacaggcatgaaggctttatatcatcattgctttacaattggtaac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27515523 |
attttatgattctttcatttttctttttcatacttatacatgcatgacagctttatatcaccatagctttacaattggtaac |
27515604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 27494073 - 27494154
Alignment:
| Q |
15 |
attttatgattctttcatttttctttttcatacttatacaggcatgaaggctttatatcatcattgctttacaattggtaac |
96 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27494073 |
attttatgattctttcatttttttttttcatacttatacatgcatgacagctttatatcaccatagctttacaattggtaac |
27494154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University