View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_low_11 (Length: 351)
Name: NF17047_low_11
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 11 - 333
Target Start/End: Original strand, 4818824 - 4819153
Alignment:
| Q |
11 |
taatactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818824 |
taatactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgc |
4818923 |
T |
 |
| Q |
111 |
gctttattaccgagtagccctttacacacgtcagtagccagcagcgcccttgtatcactggtatattttcttgaatgcaaatcctaaagcaactatcttc |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
4818924 |
gctttattaccgagtagcccttaacacacgtcagtagccagcagcgcccttgtatcactggtatcttttcttgaaggaaaatcctaaagcaactatcttc |
4819023 |
T |
 |
| Q |
211 |
ttgttagaaaatttgttaggcattgatggga-------ccagggaccacattgttcatgaaccgactcttctgataatcgttgatcttgataactttttt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4819024 |
ttgttagaaaatttgttaggcattgatgggaccagggtccagggaccacattgttcgtgaaccgactcttctgataatcgttgatcttgataacttgttt |
4819123 |
T |
 |
| Q |
304 |
ctaatattcagaaacttcaaataaaccatt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4819124 |
ctaatattcagaaacttcaaataaaccatt |
4819153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 4845208 - 4845260
Alignment:
| Q |
27 |
aaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctt |
80 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4845208 |
aaaaaatacttggctaa-ttgattcatccacaaatccctttgtatttgatcctt |
4845260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 4806155 - 4806207
Alignment:
| Q |
269 |
ctcttctgataatcgttgatcttgataacttttttctaatattcagaaacttc |
321 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| |||| ||||||||| |||||| |
|
|
| T |
4806155 |
ctcttctaataatcgttgatcttcataacttatttccaatattcagcaacttc |
4806207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University