View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_low_18 (Length: 256)
Name: NF17047_low_18
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 149
Target Start/End: Complemental strand, 45039622 - 45039480
Alignment:
| Q |
10 |
aagaatatgaaaacttccttttgttgttctctgtctggaaatgtttttatttttattga----aatgtgattgcaaagacttggtagtctatgcnnnnnn |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45039622 |
aagaaaatgaaaacttccttttgttgttctctgtctggaaatgtttttatttttattgaaattaatgtgattgcaaagacttggtagtctatgcaaaaaa |
45039523 |
T |
|
| Q |
106 |
ntttatcagaactgatcctatttattttactatttcttgacaag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039522 |
a-ttatcagaactgatcctatttattttactatttcttgacaag |
45039480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Complemental strand, 45039429 - 45039388
Alignment:
| Q |
200 |
cctgagagttgaggttatatatggccaacttagcatggttac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45039429 |
cctgagagttgaggttatatatggccaccttagcatggttac |
45039388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University