View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17047_low_19 (Length: 256)

Name: NF17047_low_19
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17047_low_19
NF17047_low_19
[»] chr4 (1 HSPs)
chr4 (141-241)||(7776586-7776686)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 141 - 241
Target Start/End: Complemental strand, 7776686 - 7776586
Alignment:
141 gtatgtatcatgtctactttaatgggttgtgtggcagaagcatgcttcgtgtctactttagtgggttgactagcataagcatgcttcaagtgagcagtat 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||    
7776686 gtatgtatcatgtctactttaatgggttgtgtggcagaagcatgcttcgtgtctacgttagtgggttgactagcataagcatgcttcaagtgaacagtat 7776587  T
241 t 241  Q
    |    
7776586 t 7776586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University