View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17047_low_21 (Length: 251)
Name: NF17047_low_21
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17047_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 33114492 - 33114707
Alignment:
| Q |
12 |
atgaacgaggtggtgttttgtactgacacatgaaaggactgagttatatataattccagaagaccagtannnnnnnnncaattgaaacttcaaagttcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33114492 |
atgaacgaggtggtgttttgtactgacacatgaaaggactgagttatatataattccagaagaccagtatttttttt-caattgaaacttcaaagttcaa |
33114590 |
T |
 |
| Q |
112 |
acaaattaagcttcaaggttcaaacttccaagaacgacagatgggtgaagtttatgtgtgtatattttggtttctccgattatgatcaattgattttata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114591 |
acaaattaagcttcaaggttcaaacttccaagaacggcagatgggtgaagtttctgtgtgtatattttggtttctccgattatgatcaattgattttata |
33114690 |
T |
 |
| Q |
212 |
ggtgtaaaattgattct |
228 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33114691 |
ggtgtaaaattgattct |
33114707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University