View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17048_low_1 (Length: 227)
Name: NF17048_low_1
Description: NF17048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17048_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 10 - 138
Target Start/End: Complemental strand, 17254172 - 17254044
Alignment:
| Q |
10 |
ccaagaatataagcgatgaagattatagaaacaagttaaagaatgctcaagtcactaaaactaggcgacaagtcacaagaagttctagtgctctcaagga |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17254172 |
ccaaaaatataagcgatgaagattatagaaacaagttaaagaattctaaagtaactaaaactaggcgacaagtcacaagaagttctagtgctctcaagga |
17254073 |
T |
|
| Q |
110 |
taataacatggttattatgagtacttcta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17254072 |
taataacatggttattatgagtacttcta |
17254044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 17247188 - 17247140
Alignment:
| Q |
90 |
agttctagtgctctcaaggataataacatggttattatgagtacttcta |
138 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||| |||||||| |
|
|
| T |
17247188 |
agttctagtgctctcaagtattataacatggttactatgactacttcta |
17247140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 17247237 - 17247197
Alignment:
| Q |
53 |
tgctcaagtcactaaaactaggcgacaagtcacaagaagtt |
93 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
17247237 |
tgctcaagtcactaaaactagaggacaagtcagaagaagtt |
17247197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University