View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17048_low_2 (Length: 201)
Name: NF17048_low_2
Description: NF17048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17048_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 179
Target Start/End: Original strand, 24794995 - 24795152
Alignment:
| Q |
22 |
acaacaaacgaattcagggttaacacggtttaaatcagctccaagttcatatttctcgaatatcattgataaagagttttatgagcatcttttcaataga |
121 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24794995 |
acaacaaatgaattcagggttaacacggtttaaatcagctccaagttcatatttttcgaatatcattgataaagagttttatgagcatcttttcaataga |
24795094 |
T |
 |
| Q |
122 |
ccttcaagtcctgaaacagaaagagtttttgcaaggtttatgaatagtcttagtggaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24795095 |
ccttcaagtcctgaaacagaaagagtttttgcaaggtttatgaatagtcttagtggaa |
24795152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 34 - 162
Target Start/End: Original strand, 42021480 - 42021608
Alignment:
| Q |
34 |
ttcagggttaacacggtttaaatcagctccaagttcatatttctcgaatatcattgataaagagttttatgagcatcttttcaatagaccttcaagtcct |
133 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||| || |||||||| | ||| || || |||||| ||||||||| ||| |||||||| |
|
|
| T |
42021480 |
ttcaggtttaacacggtttaaatcagcaccaagttcatatttcaacaacatcattgacagagaattctacgagcatgttttcaataaaccatcaagtcca |
42021579 |
T |
 |
| Q |
134 |
gaaacagaaagagtttttgcaaggtttat |
162 |
Q |
| |
|
|||||||| |||||||| |||||||||| |
|
|
| T |
42021580 |
gaaacagagcgagttttttcaaggtttat |
42021608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University