View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_18 (Length: 260)
Name: NF17049_high_18
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 1373787 - 1374004
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgagg-----tattacttgcaatatctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1373787 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggtctaatattacttgcaatatctt |
1373886 |
T |
 |
| Q |
110 |
ctcaatatatataatcgttgttttgtcgtggccaaggccacagtcacaaatttgtatttaaaacccttttgagttttgattgttaatttgtttgtggccg |
209 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
1373887 |
ctcaatatttataatcgttgttttgtcacggccaaggtcacagtcacaaatttgtatttaaaaccctt--------------ttaatttgtgtgtggccg |
1373972 |
T |
 |
| Q |
210 |
atgtgccctcaattgctgttgaactgcggttt |
241 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |
|
|
| T |
1373973 |
atgtggcctcaattgctgtcgaactgcggttt |
1374004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 1350494 - 1350571
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1350494 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaattcgagaccgaggt |
1350571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 1384148 - 1384225
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1384148 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaattcgagaccgaggt |
1384225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 1390253 - 1390330
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1390253 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaattcgagaccgaggt |
1390330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 1394499 - 1394576
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1394499 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaattcgagaccgaggt |
1394576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 1358400 - 1358477
Alignment:
| Q |
15 |
cagagaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgagaccgaggt |
92 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1358400 |
cagagaacaattggccaaagaagttgaataccttataaggaagggatgggttgcttgcttggaattcgagaccgaggt |
1358477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 7009807 - 7009872
Alignment:
| Q |
19 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgag |
84 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
7009807 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgag |
7009872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 7006716 - 7006778
Alignment:
| Q |
22 |
caattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgag |
84 |
Q |
| |
|
|||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
7006716 |
caattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgag |
7006778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University