View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_23 (Length: 240)
Name: NF17049_high_23
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_23 |
 |  |
|
| [»] scaffold0015 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 141 - 226
Target Start/End: Original strand, 18132 - 18217
Alignment:
| Q |
141 |
ataaaaattggtgtctcctagttccattcaatacctgttcttttcaaagaattgaacaagccattttcctattccatcattgagat |
226 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18132 |
ataaaaattggtgtctccttgttccattcaatacctgttcttttcaaagaattgaacaagccattttcctattccatcattgagat |
18217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 226
Target Start/End: Complemental strand, 38225 - 38186
Alignment:
| Q |
187 |
aagaattgaacaagccattttcctattccatcattgagat |
226 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
38225 |
aagaattgaacaggccattttcccattccatcattgagat |
38186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 91
Target Start/End: Original strand, 32555246 - 32555283
Alignment:
| Q |
54 |
ttgtcctcgtgaatttagcttagttgttatggacaatg |
91 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32555246 |
ttgtcctcgtgagtttagcttagttggtatggacaatg |
32555283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 91
Target Start/End: Complemental strand, 21099842 - 21099805
Alignment:
| Q |
54 |
ttgtcctcgtgaatttagcttagttgttatggacaatg |
91 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
21099842 |
ttgtcctcgtgaatttagctcagttggtatggacaatg |
21099805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 30857241 - 30857277
Alignment:
| Q |
55 |
tgtcctcgtgaatttagcttagttgttatggacaatg |
91 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30857241 |
tgtcctcgtgagtttagcttagttggtatggacaatg |
30857277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University