View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_24 (Length: 237)
Name: NF17049_high_24
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 112 - 221
Target Start/End: Complemental strand, 40648933 - 40648824
Alignment:
| Q |
112 |
ttggttataaatctgaaagccnnnnnnnagtttcattgaagtaagagttacaaatatacaactatgcgacatgttttagatatatgtgtgtgtttatgaa |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648933 |
ttggttataaatctgaaagcctttttttagtttcattgaagtaagagttacaaatatacaactatgcgacatgttttagatatatgtgtgtgtttatgaa |
40648834 |
T |
|
| Q |
212 |
caatacatct |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
40648833 |
caatacatct |
40648824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 40649091 - 40649050
Alignment:
| Q |
1 |
atgtagtaagaattttctccattgcacaaaagaaatctagaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40649091 |
atgtagtaagaattttctccattgcacaaaagaaatctagaa |
40649050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University