View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_26 (Length: 209)
Name: NF17049_high_26
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 5599949 - 5600057
Alignment:
| Q |
18 |
aatatgagactaataaaactttaatacacattttcatgcctagtgtaagtaagttagat-gggaaaattgagagtgcaa---tttttgcgtgttaatact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||| ||||||| ||| |
|
|
| T |
5599949 |
aatatgagactaataaaactttaatacacattttcatgcctagtgtaagtaaattagatggggaaaattgagagtgcaatattttttgtgtgttaaaact |
5600048 |
T |
 |
| Q |
114 |
tgtataata |
122 |
Q |
| |
|
| ||||||| |
|
|
| T |
5600049 |
tttataata |
5600057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 167
Target Start/End: Complemental strand, 33848354 - 33848312
Alignment:
| Q |
125 |
agagttcgcctcacttattctttaccccgaaattcaccgttga |
167 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
33848354 |
agagctcgcctcacttattctttacaccgaaattcacagttga |
33848312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 167
Target Start/End: Original strand, 1740857 - 1740899
Alignment:
| Q |
125 |
agagttcgcctcacttattctttaccccgaaattcaccgttga |
167 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1740857 |
agagttcgtctcacttattctttacaccgaaattcacagttga |
1740899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 125 - 186
Target Start/End: Complemental strand, 31987073 - 31987012
Alignment:
| Q |
125 |
agagttcgcctcacttattctttaccccgaaattcaccgttgatatttccggtgcttttcct |
186 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||| |||||| |||| ||| ||||||| |
|
|
| T |
31987073 |
agagctcgcctcacttattctttacgccgaagttcacagttgatgtttcttgtgtttttcct |
31987012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University