View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_7 (Length: 403)
Name: NF17049_high_7
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 320 - 394
Target Start/End: Original strand, 25491136 - 25491209
Alignment:
| Q |
320 |
cactatatgtccaactaaacttattacagcttctagcttcataatgtctttttctatcttcctaattcttctctg |
394 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
25491136 |
cactatatttctaactaaacttattacagcttctagcttcataatgtc-ttttctatcttcctaattcttgtctg |
25491209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University