View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17049_high_7 (Length: 403)

Name: NF17049_high_7
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17049_high_7
NF17049_high_7
[»] chr5 (1 HSPs)
chr5 (320-394)||(25491136-25491209)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 320 - 394
Target Start/End: Original strand, 25491136 - 25491209
Alignment:
320 cactatatgtccaactaaacttattacagcttctagcttcataatgtctttttctatcttcctaattcttctctg 394  Q
    |||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
25491136 cactatatttctaactaaacttattacagcttctagcttcataatgtc-ttttctatcttcctaattcttgtctg 25491209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University