View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_high_9 (Length: 378)
Name: NF17049_high_9
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 362
Target Start/End: Complemental strand, 39805252 - 39804891
Alignment:
| Q |
1 |
cacgatagtgacactgacatgtcgaaattggtaatacttcgagatattgaagtaattggatataatcacatgccttggtgtgccacataggttgccacta |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39805252 |
cacgacagtgacactgacatgttgaaattggtaatacttcgagatattgaagtaattggatataatcacatgccttggtgtgccacataggttgccacta |
39805153 |
T |
 |
| Q |
101 |
ctgagatgatttagagannnnnnntagtatttttgtctttaacaccaatatcttgtttgcttctgttggtggcaattgcttttcacttctatgcatgttc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39805152 |
ctgagatgatttagagagggggggtagtatttttgtctttaacaccaatatcttgtttgcttctgttggtggcaattgcttttcacttctatgcatgttc |
39805053 |
T |
 |
| Q |
201 |
cacacccttgcagtttattgcgtatggacccgggtctaaagacaaacagagaggctgaactgctttttctgttttgaaatgtcactatggcccatgtcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39805052 |
cacacccttgcagtttattgcgtatggacccgggtctaaagacaaacagagaggctgaactgctttttctgttttgaaatgtcactatggcccatgtcat |
39804953 |
T |
 |
| Q |
301 |
gcccacacaaagtgccaagaggtcatggtcttgaacaaacaaatcagtgtgtagtgatgaat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39804952 |
gcccacacaaagtgccaagaggtcatggtcttgaacaaacaaatcagtgtgtagtgatgaat |
39804891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University