View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17049_low_24 (Length: 259)
Name: NF17049_low_24
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17049_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 34569249 - 34569019
Alignment:
| Q |
17 |
ataaacctcaaaacatctagagaccttgctaacttaaacgtcaaagtgtctttgcaggtagaccaccatgtgcaggtaaagaacaaccatcgtcaacaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34569249 |
ataaacctcaaaacatctagagaccttgctaacttaaacgtcaaagtgtctttgcaggtagaccaccatgtgcaggtaaagaacaaccatcgtcaacaac |
34569150 |
T |
|
| Q |
117 |
aacacaaaatcttagaacccactccatttggctcgtattatcatgcaccgatcaaataccatgtgaaatctgaaggcatatatttttaatattttaaaag |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34569149 |
aacacaaaatcttagaatccactccatttggctcgtattatcatgcacagatcaaataccatgtgaaatttgaaggcatatatttttaatattttaaaag |
34569050 |
T |
|
| Q |
217 |
aagtatactattgcaccataaaagtaatatt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34569049 |
aagtatactattgcaccataaaagtaatatt |
34569019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 210 - 247
Target Start/End: Complemental strand, 34568958 - 34568921
Alignment:
| Q |
210 |
ttaaaagaagtatactattgcaccataaaagtaatatt |
247 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
34568958 |
ttaagagaagtatactattgcaccataaaagcaatatt |
34568921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University