View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_25 (Length: 295)
Name: NF1704_high_25
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 94 - 232
Target Start/End: Complemental strand, 52348322 - 52348185
Alignment:
| Q |
94 |
gtccgtataatgatcatgtcagtatcactgacactgaatccagctcaatcatcttgtcttttacaaaactccaaccatcatcatgtctcaaaagaatgac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52348322 |
gtccgtataatgatcatgtcagtatcactgacactgaatccagctcaatcatcttgtcttttacaaaactccaacca-catcatgtctcaaaagaatgac |
52348224 |
T |
 |
| Q |
194 |
aaaaacgaaaggtagttaggaggcaacgcaaaatgtagc |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52348223 |
aaaaacgaaaggtagttaggaggaaacgcaaaatgtagc |
52348185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 277
Target Start/End: Complemental strand, 52348152 - 52348113
Alignment:
| Q |
238 |
tgtggtttcatgatattattgatgcacggttgcacccacc |
277 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52348152 |
tgtggtttcatgctattattgatgcacggttgcacccacc |
52348113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University