View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_27 (Length: 287)
Name: NF1704_high_27
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 10 - 273
Target Start/End: Original strand, 34315761 - 34316024
Alignment:
| Q |
10 |
ataattctagctaggatgagatgatagtactggtctcttttaacttaattaaccaaggtgtttaaattgacattcataacaacattaaaaggtattgagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34315761 |
ataattctagctaggatgagatgatagtactggtctcttttaacttaattaaccaaggtgtttaaattgacactcataacaacattaaaaggtattgagg |
34315860 |
T |
 |
| Q |
110 |
aagagttttgtgcctcatgtgtcttacttggttcgagatattagtcttaatagtcttatattcatcttcatcttctaacacttatctatcttgtgctctc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34315861 |
aagagttttgtgcctcatgtgtcttacttggttcgagatattagtcttaatagtcttatattcatcttcatcttctaacacttatctatcttgtgctctc |
34315960 |
T |
 |
| Q |
210 |
agtgaccacatgttgcttagcaatagaggctcttaagaagctccgcgaaagtaaaggtacatat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34315961 |
agtgaccacatgttgcttagcaatagaggctcttaagaagctccgcgaaagtaaaggtacatat |
34316024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University