View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_29 (Length: 274)
Name: NF1704_high_29
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 53042685 - 53042445
Alignment:
| Q |
18 |
cagcacgtcctcctagaactgcatccaactcaactgttttgatggctgcggcaccagcttcatcctattttatagttatgatcaccattgagtaaatggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042685 |
cagcacgtcctcctagaactgcatccaactcaactgttttgatggctgcggcaccagcttcatcctattttatagttatgatcaccattgagtaaatggg |
53042586 |
T |
|
| Q |
118 |
aaaattataacaaatagtgaactaaaaacaggcgaaaggggatgagaatatacgaacaataaaacttacctgactggtgtctttaccaagccaataatga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042585 |
aaaattataacaaatagtgaactaaaaacaggcgaaaggggatgacaatatacgaacaataaaacttacctgactggtgtctttaccaagccaataatga |
53042486 |
T |
|
| Q |
218 |
atatcatggcgcagagcaccactttttgatgccgttgtcta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042485 |
atatcatggcgcagagcaccactttttgatgccgttgtcta |
53042445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 15965204 - 15965275
Alignment:
| Q |
18 |
cagcacgtcctcctagaactgcatccaactcaactgttttgatggctgcggcaccagcttcatcctatttta |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
15965204 |
cagcacgtcctccgagagctgcatccagctcaactgtcttgatggctgcagcaccagcttcatcctgtttta |
15965275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 258
Target Start/End: Original strand, 15965368 - 15965443
Alignment:
| Q |
183 |
ttacctgactggtgtctttaccaagccaataatgaatatcatggcgcagagcaccactttttgatgccgttgtcta |
258 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| || ||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
15965368 |
ttacctgactggtgtctttaccaatccagtaatggatgtcatgacgcagagcaccactttttgaggcagttgtcta |
15965443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University