View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_35 (Length: 260)
Name: NF1704_high_35
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_35 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 167 - 260
Target Start/End: Original strand, 16841823 - 16841916
Alignment:
| Q |
167 |
tcatgtatgtcttatagtaaatcatcatctattggtgattctacgtcttcaatttgtgctaggtgtgaaaaatatatattaattaatatacttt |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16841823 |
tcatgtatgtcttattgtaaatcatcatctattggtgattctatgtcttcaatttatgctaggtgtgagaaatatatattaattaatatacttt |
16841916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 71 - 145
Target Start/End: Original strand, 16841732 - 16841804
Alignment:
| Q |
71 |
accaattgacataaacttatatcgatnnnnnnnngtagtgtcacaacaatgaattttaacattctcccttttttg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16841732 |
accaattgacataaacttatatcgat--aaaaaagtagtgtcacaacaatgaattttaatattctcccttttttg |
16841804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University