View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_37 (Length: 250)
Name: NF1704_high_37
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_37 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 33 - 250
Target Start/End: Complemental strand, 51215697 - 51215481
Alignment:
| Q |
33 |
gtaaaaatattttccgttcggtttgaaaccactgaatcggtgcaccgaacctttatactagtttgtttcggtcctggatgaaccattaacggtttggttc |
132 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
51215697 |
gtaaaaatattttccgtttggtttgaaaccactgaatcggtgcaccgaacctttatactagtttgtttaggtcctggatgaaccattaaaggtttggttc |
51215598 |
T |
|
| Q |
133 |
attcttaccgaagtagtaaaagttcattttggtttcctttcttaacagaaccataaacagttttagtgtttgtgtacgtgtcaatgcttcgtaaatttct |
232 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51215597 |
attcttaccgaagtagtaaaagttcagtttggtttcctctcttaacagaaccataaaca-atttagtgtttgtgtacgtgtcaatgcttcataaatttct |
51215499 |
T |
|
| Q |
233 |
gtagtttacctgctgcaa |
250 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51215498 |
gtagtttacctgctgcaa |
51215481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University