View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_38 (Length: 249)
Name: NF1704_high_38
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_38 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 785915 - 786156
Alignment:
| Q |
14 |
ttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacctttgtaaccatgggatatgtttatgattgatttctttgaggc--- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785915 |
ttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacctttgtaaccatgggatatgtttatgattgatttctttgaggcttt |
786014 |
T |
 |
| Q |
111 |
---aaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggcaaagatttagccactttcggcaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786015 |
ggcaaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggcaaagatttagccactttcggcaaa |
786114 |
T |
 |
| Q |
208 |
acaaagtataggaggaagtgtgcaagcatggctaaagaaaac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786115 |
acaaagtataggaggaagtgtgcaagcatggctaaagaaaac |
786156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University