View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_high_41 (Length: 245)
Name: NF1704_high_41
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_high_41 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 49583877 - 49584112
Alignment:
| Q |
10 |
aatatcagagatggtgtggatgtagggaaggcaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaaggcaacgtgagcttttgtttcg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49583877 |
aatatcagagatggtgtggatgtagggaagggaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaaggcaacgtgagcttttgtttcg |
49583976 |
T |
|
| Q |
110 |
tctgatgccgaatgtaccggaggaagttcaaaacgaattacttgaggtaatgacataaacaatttcaaagtttttcattttaatatcgattgttactccg |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49583977 |
tctgataccgaatgtaccggaggaagttcaaaatgaattacttgaggtaatgacataaacaatttcaaagtttttcattttaatatcgattgttactccg |
49584076 |
T |
|
| Q |
210 |
tccactgacatggattggatctatacatatttattt |
245 |
Q |
| |
|
|||| || |||||||||||||||||| |||| |||| |
|
|
| T |
49584077 |
tccattgtcatggattggatctatacttattgattt |
49584112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University