View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_low_28 (Length: 298)
Name: NF1704_low_28
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 6 - 281
Target Start/End: Original strand, 49584209 - 49584484
Alignment:
| Q |
6 |
aaaatttaactgggctcaaagcccttgttgatggattagcaatcggtaaaggnnnnnnngatcttatatgcccccatgttgatgatgtaaaatccaatga |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584209 |
aaaatttaattgggctcaaagcccttgttgatggattagcaatcggtaaaggaaaaaaagatcttatatgcccccatgttgatgatgtaaaatccaatga |
49584308 |
T |
 |
| Q |
106 |
agttgttctggtcggtccttcaaaaataccgaagggaaaagcttgtgcaatgcttgaaccctcagaaataataagctttctgacaggaaatttcagatta |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49584309 |
agctgttctggtcggtccttcaaaaataccgaagggaaaagcttgtgcaatgcttgaaccctcagaaataataagctttctgacaggaaacttcagatta |
49584408 |
T |
 |
| Q |
206 |
agtaaatctcgaactgatgatctctttcgggaagccgtttggcctcgtctacttgcaagaggttggcactcggagg |
281 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584409 |
agtaaatctcgaactgatgatctcttttgggaagccgtttggcctcgtctacttgcaagaggttggcactcggagg |
49584484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 15769610 - 15769556
Alignment:
| Q |
222 |
atgatctctttcgggaagccgtttggcctcgtctacttgcaagaggttggcactc |
276 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15769610 |
atgatctcttctgggaagctgtttggcctcgcttactggcaagaggttggcactc |
15769556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 46643193 - 46643141
Alignment:
| Q |
224 |
gatctctttcgggaagccgtttggcctcgtctacttgcaagaggttggcactc |
276 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
46643193 |
gatctcttctgggaagctgtttggcctcgattactggcaagaggttggcactc |
46643141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University