View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_low_37 (Length: 265)
Name: NF1704_low_37
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 33320956 - 33320702
Alignment:
| Q |
1 |
attagatcatccgtgatggcacatgaattaaagattgaaagtggagaaaccagatgggttatagataccattctcggcaaagacgttggactaggagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33320956 |
attagatcatccgtgatggcacatgaattaaagattgaaagtggagaaaccagatgggttatagataccattctcggcaaagacgttggactaggagttg |
33320857 |
T |
 |
| Q |
101 |
aaaacttgagtggcagtggggccattgccggtgcctattcaagggcatacaaggaaacctttacactaacatatgtgaccggtacaactgttggaattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33320856 |
aaaacttgagtggcagtggggccattgccggtgcctattcaagggcatacaaggaaacctttacactaacatatgtgaccggtacaactgttggaattgg |
33320757 |
T |
 |
| Q |
201 |
tgcttatcttgcaaggcttgggatgagatgcatacagaggtttgatcagcctatg |
255 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33320756 |
tgcttatcttgcaaggctggggatgagatgcatacagaggtttgatcagcctatg |
33320702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 5 - 254
Target Start/End: Complemental strand, 33346074 - 33345825
Alignment:
| Q |
5 |
gatcatccgtgatggcacatgaattaaagattgaaagtggagaaaccagatgggttatagataccattctcggcaaagacgttggactaggagttgaaaa |
104 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||| | |||||| ||||||||||| |
|
|
| T |
33346074 |
gatcatcagtgatggcacatgaattaaaacttgaaagtggagaaaccagatgggttatagataccattgttggcaaagaagatggactgggagttgaaaa |
33345975 |
T |
 |
| Q |
105 |
cttgagtggcagtggggccattgccggtgcctattcaagggcatacaaggaaacctttacactaacatatgtgaccggtacaactgttggaattggtgct |
204 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
33345974 |
cttgagtggtagtggggccattgctggtgcctattcaagggcatacaaggaaacctttacattgacatatgttaccggtaggactgttggaattggtgct |
33345875 |
T |
 |
| Q |
205 |
tatcttgcaaggcttgggatgagatgcatacagaggtttgatcagcctat |
254 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
33345874 |
tatcttgctaggcttgggatgaggtgcatacagaggcttgatcagcctat |
33345825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University