View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1704_low_46 (Length: 245)

Name: NF1704_low_46
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1704_low_46
NF1704_low_46
[»] chr4 (1 HSPs)
chr4 (10-245)||(49583877-49584112)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 49583877 - 49584112
Alignment:
10 aatatcagagatggtgtggatgtagggaaggcaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaaggcaacgtgagcttttgtttcg 109  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49583877 aatatcagagatggtgtggatgtagggaagggaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaaggcaacgtgagcttttgtttcg 49583976  T
110 tctgatgccgaatgtaccggaggaagttcaaaacgaattacttgaggtaatgacataaacaatttcaaagtttttcattttaatatcgattgttactccg 209  Q
    |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49583977 tctgataccgaatgtaccggaggaagttcaaaatgaattacttgaggtaatgacataaacaatttcaaagtttttcattttaatatcgattgttactccg 49584076  T
210 tccactgacatggattggatctatacatatttattt 245  Q
    |||| || |||||||||||||||||| |||| ||||    
49584077 tccattgtcatggattggatctatacttattgattt 49584112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University