View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704_low_54 (Length: 208)
Name: NF1704_low_54
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 39890308 - 39890455
Alignment:
| Q |
1 |
aaacgacacattttcatggcaatcgactatctaaaaagagaaaacatgtaacnnnnnnnctttctatttcagacaagtagttgggagggatcgagacgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39890308 |
aaacgacacattttcatggcaatcgactatctaaaaagagaaaacatgtaactttttttctttctatttcagacaagtagttgggagggatcgagacgaa |
39890407 |
T |
 |
| Q |
101 |
acgagcaacttttacaccccgtacatttctaaaaaattaaattagttt |
148 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39890408 |
acaagcaacttttgcaccccgtacatttctaaaaaattaaattagttt |
39890455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University